Genosignature Protocols

• E. coli

  λ-Red recombineering

  Goto CellRepo Repository

  Steps

  Day 1	1. Start an overnight culture (37 °C) by inoculating LB medium with a single colony.
  Day 2	2. Prepare competent cells following your favourite protocol. 3. Transform E. coli cells with plasmid pKD46 and plate the cells at 30 °C in LB supplemented with 100 µg/mL ampicillin (or carbenicillin).
  Day 3	4. Start an overnight culture at 30 °C in LB/Amp from a single colony transformant.
  Day 4	5. Next morning refresh the culture (1:100) with LB/Amp and grow the cells until OD600 reaches 0.1. 6. Add arabinose to a final concentration of 30 mM and grow the cells to an OD600 =0.5 (recombination proteins are being expressed at this point). 7. Freeze cells on ice for 20 minutes and prepare electrocompetent cells by washing bacteria with ice-cold milli-Q water after spinning aliquots 10 minutes at 5000 rpm in a 4 °C centrifuge. 8. After two washes, resuspend cells in the residual water and electroporate with 500 ng of the Genosignature™ DNA cassette (coming from the amplification of pEC-Red2-BC) with a Gene Pulser (25 μF, 200 Ω at 1.8 kV). 9. After electroporating the cells, add 950 μl of fresh LB without antibiotics to samples and resuspended cultures are grown for 2 hours at 37 °C. 10. Plate cells in LB supplemented with chloramphenicol 25 µg/mL.
  Day 5	11. Restreak colonies on LB/CM and grow overnight at 37°C.
  Day 6	12. Perform PCR and sequencing experiments to confirm the insertion of the Genosignature™. 13. To remove the antibiotic cassette, the pCP20 plasmid is transformed. Prepare liquid culture of cells containing the barcoding cassette in LB/Cam.
  Day 7	14. Prepare competent cells and transform pCP20 at 30 °C. 15. Plate in LB/Cam/Amp
  Day 8	16. After pCP20 transformation, inoculate single colonies in LB/Amp/Cam and grow overnight at 30 °C.
  Day 9	17. Next morning, dilute cells in LB and grow at 30 °C until OD600 reaches 0.1 18. Swap cells to 42 °C incubator and grow until OD600 reaches 0.9. 19. Spot 30 μL in LB plate, streak over the plate and incubated at 37 °C.
  Day 10	20. Barcode presence is checked again by PCR and sequencing. 21. Restreak single colonies in three different plates (LB, Cam and Amp) to check that the resistance is loss.

  CRISPR

  Goto CellRepo Repository

  Steps

  Day 1	1. Start an overnight culture (37 °C) by inoculating LB medium with a single colony.
  Day 2	2. Prepare competent cells following your favourite protocol. 3. Transform E. coli cells with plasmid pREDCas9 and plate the cells at 30 °C in LB supplemented with 50 µg/mL spectinomycin
  Day 3	4. Start an overnight culture at 30 °C in LB/Spec from a single colony.
  Day 4	5. Next morning refresh the culture with LB/Spec and grow the cells until OD600 reaches 0.1. 6. Add IPTG to a final concentration of 2 mM and grow the cells to an OD600 =0.6 (recombination proteins are being expressed at this point). 7. Frost cells on ice for 20 minutes and electrocompetent cells are then prepared by washing bacteria with ice-cold milliQ water after spinning aliquots 10 minutes at 5000 rpm in a 4 °C centrifuge. (Heat shock transformation also could be performed) 8. After two washes, resuspend cells in the residual milliQ water and electroporate with pEC-CRISPR2-BC. 9. Add 950 μl of fresh LB without antibiotics and resuspend cells. Incubate cells 1 hour at 30 °C. 10. Then, spread 100 μL of bacterial culture on LB plates supplemented with Spec (50 µg/mL) /Amp (100 µg/mL).
  Day 5	11. Check colonies for Genosignature™ presence by colony-PCR. 12. Inoculate a positive clone in 2 mL of LB/Spec/Ara (30 mM) (sgRNA targeting pUC origin in pEC-CRISPR2-BC is expressed). 13. Grow for 4-6 hours. 14. Plate on LB/Spec.
  Day 6	15. Check some colonies for Ampicillin resistance by restreaking them on LB/Amp.
  Day 7	16. Take a sensitive clone and restreak it on LB plates at 37°C.
  Day 8	17. Check again by colony PCR the presence of the Genosignature™ and restreak on LB/Spec and LB/Amp plates to double check plasmid curing. %tr

  Note: Different sgRNA sequences were used in different experiments (obtained using 3):

  • Final sgRNA1: 5’ - promoter – ATTCCGCGTAAGTATCGCGG– scaffold – terminator 3’
  • Final sgRNA2: 5’ - promoter – CGTACAAAAGTACGTGAGGA– scaffold – terminator 3’

• B. subtilis

  The toxin-antibiotic cassette assembly was achieved by HiFi assembly (NEB) of all the parts. The final product was PCR amplified and transformed into 168 cells.

  mazF toxin mediated barcoding

  Goto CellRepo Repository

  Steps

  Day 1	1. Start an overnight culture (37 °C) by inoculating LB medium with a single colony.
  Day 2	2. Prepare competent cells following your favourite protocol. 3. Transform E. coli cells with plasmid pKD46 and plate the cells at 30 °C in LB supplemented with 100 µg/mL ampicillin (or carbenicillin).
  Day 3	4. Start an overnight culture at 30 °C in LB/Amp from a single colony transformant.
  Day 4	5. Next morning refresh the culture (1:100) with LB/Amp and grow the cells until OD600 reaches 0.1. 6. Add arabinose to a final concentration of 30 mM and grow the cells to an OD600 =0.5 (recombination proteins are being expressed at this point). 7. Freeze cells on ice for 20 minutes and prepare electrocompetent cells by washing bacteria with ice-cold milli-Q water after spinning aliquots 10 minutes at 5000 rpm in a 4 °C centrifuge. 8. After two washes, resuspend cells in the residual water and electroporate with 500 ng of the Genosignature™ DNA cassette (coming from the amplification of pEC-Red2-BC) with a Gene Pulser (25 μF, 200 Ω at 1.8 kV). 9. After electroporating the cells, add 950 μl of fresh LB without antibiotics to samples and resuspended cultures are grown for 2 hours at 37 °C. 10. Plate cells in LB supplemented with chloramphenicol 25 µg/mL.
  Day 5	11. Restreak colonies on LB/CM and grow overnight at 37°C.
  Day 6	12. Perform PCR and sequencing experiments to confirm the insertion of the Genosignature™. 13. To remove the antibiotic cassette, the pCP20 plasmid is transformed. Prepare liquid culture of cells containing the barcoding cassette in LB/Cam.
  Day 7	14. Prepare competent cells and transform pCP20 at 30 °C. 15. Plate in LB/Cam/Amp
  Day 8	16. After pCP20 transformation, inoculate single colonies in LB/Amp/Cam and grow overnight at 30 °C.
  Day 9	17. Next morning, dilute cells in LB and grow at 30 °C until OD600 reaches 0.1 18. Swap cells to 42 °C incubator and grow until OD600 reaches 0.9. 19. Spot 30 μL in LB plate, streak over the plate and incubated at 37 °C.
  Day 10	20. Barcode presence is checked again by PCR and sequencing. 21. Restreak single colonies in three different plates (LB, Cam and Amp) to check that the resistance is loss.

  Cre-Lox

  Goto CellRepo Repository

  Steps

  Day 1	1. Start an overnight culture (37 °C) by inoculating LB medium with a single colony.
  Day 2	2. Prepare competent cells following your favourite protocol. 3. Transform E. coli cells with plasmid pREDCas9 and plate the cells at 30 °C in LB supplemented with 50 µg/mL spectinomycin
  Day 3	4. Start an overnight culture at 30 °C in LB/Spec from a single colony.
  Day 4	5. Next morning refresh the culture with LB/Spec and grow the cells until OD600 reaches 0.1. 6. Add IPTG to a final concentration of 2 mM and grow the cells to an OD600 =0.6 (recombination proteins are being expressed at this point). 7. Frost cells on ice for 20 minutes and electrocompetent cells are then prepared by washing bacteria with ice-cold milliQ water after spinning aliquots 10 minutes at 5000 rpm in a 4 °C centrifuge. (Heat shock transformation also could be performed) 8. After two washes, resuspend cells in the residual milliQ water and electroporate with pEC-CRISPR2-BC. 9. Add 950 μl of fresh LB without antibiotics and resuspend cells. Incubate cells 1 hour at 30 °C. 10. Then, spread 100 μL of bacterial culture on LB plates supplemented with Spec (50 µg/mL) /Amp (100 µg/mL).
  Day 5	11. Check colonies for Genosignature™ presence by colony-PCR. 12. Inoculate a positive clone in 2 mL of LB/Spec/Ara (30 mM) (sgRNA targeting pUC origin in pEC-CRISPR2-BC is expressed). 13. Grow for 4-6 hours. 14. Plate on LB/Spec.
  Day 6	15. Check some colonies for Ampicillin resistance by restreaking them on LB/Amp.
  Day 7	16. Take a sensitive clone and restreak it on LB plates at 37°C.
  Day 8	17. Check again by colony PCR the presence of the Genosignature™ and restreak on LB/Spec and LB/Amp plates to double check plasmid curing. %tr

  Note: Different sgRNA sequences were used in different experiments (obtained using 3):

  • Final sgRNA1: 5’ - promoter – ATTCCGCGTAAGTATCGCGG– scaffold – terminator 3’
  • Final sgRNA2: 5’ - promoter – CGTACAAAAGTACGTGAGGA– scaffold – terminator 3’

  CRISPR

  Goto CellRepo Repository

  Steps

  Day 1	1. Start an overnight culture 37 °C in minimal medium.
  Day 2	2. Dilute cells 1:10 in MM and grown for 3 h at 37 °C. Meanwhile, starvation medium is prepared and prewarmed at 37 °C. 3. Dilute in 1:2 SM and make competent cells with a further 2 h incubation period at 37 °C. 4. Mix 400 μl cell with 400 ng pBS-CRISPR-BC. Spin down cells and plate on LB supplemented with 5 μg/mL kanamycin and 0.2% mannose and incubate at 30 °C for 1 h.
  Day 3	5. Check Genosignature™ presence by colony-PCR. 6. Cure positive clones from pBS-CRISPR-BC by restreaking them at 37 °C in LB plates.
  Day 4	7. Store kanamycin sensitive clones as Genosignature™.

  Final sgRNA: 5’ - promoter – GGAAAAGAGTATATTAGATA – scaffold – terminator 3’. sgRNA sequences obtained using 3. 

• P. putida

  The barcoding protocol using TargeTron was adapted from E. coli8 to P. putida9. The Genosignature™ sequence was synthesized by PCR with two overlapping oligonucleotides. Afterwards, this PCR fragment was directly cloned into MluI-digested pSEVA6511-GIIi by Gibson Assembly to generate pSEVA6511-GIIi-BC. The generation of pSEVA231-C-94a is explained elsewhere10. Details on how the TargeTron system works as a Genosignature™ deliverer in P. putida can be found in Fig. S3. After generating these two plasmids, the barcoding protocol was carried out as follows:

  CRISPR/targetron

  Goto CellRepo Repository

  Steps

  Day 1	1. Start an overnight culture (30° C) by inoculating LB medium from a single colony..
  Day 2	2. Transform plasmid pSEVA421-Cas9tr into P. putida strain either by electroporation11 or conjugation12: o Electroporation: Briefly, wash an overnight culture with 300mM sucrose at room temperature four times. At the end, resuspend pellet in 400 μL of sucrose and separate in 100 μL aliquots. After adding 100 ng of pSEVA421-Cas9tr to one aliquot, carry out the electrical shock (program in Gene Pulser from Bio-Rad: 2.5 kV, 25 µF, 200 Ω.) and plate on LB supplemented with streptomycin (100 µg/mL). o Conjugation: Tri-parental mating can be performed for the mobilization of pSEVA plasmids from E. coli to P. putida strains. Briefly, take 1 mL from overnight cultures of donor (E. coli strain bearing pSEVA421-Cas9tr), helper (in our case, E. coli HB101 with plasmid pRK600) and recipient P. putida strain. Spin down cells and wash once with 10mM MgSO4. Mix 100 µL from each washed culture and spin down cells to eliminate the supernatant. Finally, resuspend the final pellet in 20 µL of MgSO4 and spot on a LB agar plate. When dry, incubate for at least 4h at 30°C and then, recuperate cells, resuspend them on MgSO4 and plate serial dilution on M9 minimal media supplemented with sodium citrate at 0.2% (w/v) and streptomycin.
  Day 3	3. Select single colonies resistant to streptomycin and start a new culture.
  Day 4	4. Transform plasmid pSEVA6511-GIIi-BC by following one of the same two procedures described above.
  Day 5	5. Select single colonies resistant to streptomycin and gentamycin (15 µg/mL) 6. Start a new culture (20 mL of LB supplemented with streptomycin and gentamycin is recommended)
  Day 6	7. Induce the overnight culture with 1mM cyclohexanone for 4h at 30° C 8. Make competent cells by following the procedure explained before Electroporate 100 ng of pSEVA231-C-94a into one aliquot of competent cells and recover the culture for 2 h in LB supplemented with streptomycin. 9. Plate the cells on LB plates supplemented with streptomycin and kanamycin (50 µg/mL).
  Day 7	10. Check by PCR the presence of the Genosignature™ at the correct locus and start giving passages with no antibiotic selection to cure plasmids.

• S. albidoflavus

  pCRISPomyces-2 vector was used to engineer S. albidoflavus J1074. Using the vector construction protocol detailed in13, pSA-CRISPR vector was built (testing two different sgRNA sequences). By Hi-Fi assembly, the Genosignature™ sequence was cloned. To transform this vector into S. albidoflavus J1074, the protocol detailed in 14 was followed. pCRISPomyces-2 was a gift from Huimin Zhao (Addgene plasmid # 61737).

  Note: Two sgRNA sequences used (obtained using 5):

  • sgRNA1: 5’ - promoter – TCATCGTTCTCAATACACCG– scaffold – terminator 3’
  • sgRNA2: 5’ - promoter – TGCAACCTCCGTGATCATTC– scaffold – terminator 3’

  CRISPR

  Goto CellRepo Repository

  Steps

  Day 1	1. Start an overnight culture of E. coli ET12567 (conjugative strain used to transform by the plasmid into Streptomyces species) at 37°C in LB supplemented with Chloramphenicol and Kanamycin.
  Day 2	2. Prepare competent cells of E. coli ET12567. 3. Transform using your favourite protocol with pSA-CRISPR-BC. 4. Plate in LB supplemented with chloramphenicol (25 μg/mL), kanamycin (50 μg/mL) and apramycin (50 μg/mL).
  Day 3	5. Pick one colony and inoculate 5 mL of LB supplemented with Chloramphenicol, Kanamycin and Apramycin.
  Day 4	6. Pellet down cells. 7. Wash cells 3 times with 1 mL 2xYT media. 8. Heat shock ~108 S. albidoflavus spores in 100 uL of 2xYT at 50°C for 10 min. 9. Use the 100uL spores to resuspend the E. coli pellet. 10. Plate on MS-agar supplemented with 20mM MgCl2. 11. Incubate overnight at 30°C.
  Day 5	12. Dissolve Apramycin and Nalidixic Acid (which does not act against S. albidoflavus) in 1mL H2O. 13. Overlay the antibiotic mixture on the plates. Let them dry. 14. Incubate at 30°C for 1 week.
  Day 6	15. Restreak 10 S. albidoflavus colonies on MS/Nal at 37°C to cure the plasmids. 16. Grow until colonies appear. 17. Repeat three times.
  Day 7	18. Restreak on MS-agar/Apra to check plasmid curing.
  Day 8	19. Extract genomic DNA of cells using Sigma’s Genomic extraction Kit. 20. Check Genosignature™ presence by PCR.

• S. cerevisiae

  Cre-Lox

  Goto CellRepo Repository

  Steps

  Day 1	1. Start an overnight culture of S. cerevisiae cells in YPD.
  Day 2	2. Inoculate 5mL of YPD with 500uL of culture at 30°C. 3. Incubate until OD=0.2-0.3. 4. Prepare competent cells by the LiAc method. 5. Transform with the PCR product coming from the cassette amplification of pSC-CreLox-BC ((both KanMX and URA3 markers were tested) 6. Incubate in YPD for 2 hours (if the selected marker is URA3, this step can be skipped). 7. Plate on YPD supplemented with 200 μg/mL of G418 (or SC -uracil) at 30°C.
  Day 3	8. Wait until colonies appear. 9. Check by PCR Genosignature™ presence. 10. Inoculate one positive clone in YPD.
  Day 4	11. Repeat protocol of Day 1 to transform pBF3060_NatMX (cre recombinase expression). 12. Plate on YPD supplemented with 100 μg/mL Neurothreocin. 13. Plate at 30°C.
  Day 5	14. Inoculate 2 mL of appropriate media to maintain selection but with 2% Raffinose /0.1% Glucose as the carbon source. 15. Grow overnight at 30°C.
  Day 6	16. Make a 1/10 dilution using the appropriate selection media supplemented with 2% Galactose and 0.1% Glucose (this induces the expression of CreA). 17. Plate cells in YPD/Neurothreocin.
  Day 7	18. Check selection cassette removal by colony PCR 19. Inoculate 2 mL of YPD without antibiotic with a positive clone (this step may need to be repeated 2 or 3 days to allow the plasmid curation). 20. Grow overnight at 30°C.
  Day 8	21. Plate on YPD after dilution looking for single colonies. 22. Check the single colonies for Neurothreocin sensitivity (pSC-Crelox-BC curation).

  pBF3060 was a gift from Nancy DaSilva & Suzanne Sandmeyer (Addgene plasmid # 26850).

  CRISPR

  Goto CellRepo Repository

  Steps

  Day 1	1. Start an overnight culture of S. cerevisiae cells in YPD.
  Day 2	2. Inoculate 5mL of YPD with 500uL of culture at 30°C. 3. Incubate until OD=0.2-0.3 4. Prepare competent cells by the LiAc method. 5. Transform with pCfBf2312 (Cas9). 6. Incubate in YPD for 2 hours. 7. Plate on YPD supplemented with 200 μg/mL G418 at 30°C.
  Day 3	8. Wait until colonies appear. 9. Inoculate a positive clone into YPD/G418 at 30°C.
  Day 4	10. Repeat protocol of Day 1 to co-transform pCfBf3020 (gRNA) and the PCR product coming from pSC-CRISPR-BC. 11. Incubate in YPD for 2 hours. 12. Plate on YPD supplemented with Neurothreocin (100 μg/mL) and G418 (200 μg/mL) at 30°C.
  Day 5	13. Wait until colonies appear. 14. Check by PCR Genosignature™ presence 15. Inoculate a positive clone in YPD without antibiotic (this step may need to be repeated 2 or 3 days to allow the plasmids curation).
  Day 6	16. Plate on YPD after dilution looking for single colonies. 17. Test Neurothreocin and G418 sensitive colonies.

  In short, the procedure is based on two plasmids and a PCR repair template. pCfBf2312, pCfBf2899 and pCfBf3020 were a gift from Irina Borodina (Addgene plasmid # 78231, 73271 and 73282 respectively).

  sgRNA: 5’ - promoter – CTCTCGAAGTGGTCACGTGC– scaffold – terminator 3’.

• K. phaffi

  Goto CellRepo Repository

  Adapted from “Thermo Fisher Scientific’s pPICZ A, B, and C transformation protocol (Manual part no. 25-0148)”. A version of pPICZ vector, pICXNH317 was used to create our vector. The Genosignature™ sequence was inserted after the AOX1 terminator sequence. The vector allows the integration of any desired protein after the AOX1 promoter. SacI was used to linearize the plasmid. pICXNH3 was a gift from Raimund Dutzler & Eric Geertsma (Addgene plasmid # 49020).

  Steps

  Day 1	1. Digest ~5–10 μg of Genosignature™ plasmid DNA with SacI 2. Check linearization in agarose gel 3. Column purify the digestion reaction 4. Grow 5 mL of Pichia pastoris strain in YPD at 30°C overnight.
  Day 2	5. Inoculate 50 mL of fresh medium with the overnight culture. 6. Grow overnight again to an OD600 = 1.3–1.5.
  Day 3	7. Centrifuge the cells at 1,500 × g for 5 minutes at 4°C. Resuspend the pellet with 500 ml of ice-cold, sterile water. 8. Centrifuge again, then resuspend the pellet with 250 ml of ice cold, sterile water. 9. Centrifuge again, then resuspend the pellet in 20 ml of ice-cold 1 M sorbitol. 10. Centrifuge again, then resuspend the pellet in 1 ml of ice-cold 1 M sorbitol for a final volume of approximately 1.5 ml. Keep the cells on ice and use that day. Do not store cells. 11. Mix 80 μL of the cells from Step 6 (previous page) with 5–10 μg of linearized DNA (in 5–10 μL sterile water) and transfer them to an ice-cold 0.2 cm electroporation cuvette. 12. Incubate the cuvette with the cells on ice for 5 minutes. 13. Pulse the cells using the manufacturer’s instructions for Saccharomyces cerevisiae. 14. Immediately add 1 ml of ice-cold 1 M sorbitol to the cuvette. Transfer the cuvette contents to a sterile 15-ml tube and incubate at 30°C without shaking for 1 to 2 hours. 15. Spread 10, 25, 50, 100, and 200 μl each on separate, labelled YPDS plates containing 100 μg/ml Zeocin. Plating at low cell densities favours efficient Zeocin™ selection. 16. Incubate plates from 3–10 days at 30°C until colonies form.
  Day 4	17. Pick 10–20 colonies and purify (streak for single colonies) on fresh YPD or YPDS plates containing 100 μg/ml Zeocin.
  Day 5	18. Colony PCR to check Genosignature™ presence.

• Recipies for media

  LB (1 L):

  • 10 g tryptone
  • 10 g NaCl
  • 5 g yeast extract
  • Up to 1 L distilled water

  SMM (1 L):

  • 2 g Ammonium sulphate
  • 14 g Dipotassium hydrogen phosphate
  • 6 g potassium dihydrogen phosphate
  • 1 g trisodioum citrate dihydrate
  • 0.2 g magnesium sulphate heptahydrate
  • Up to 1 L distilled water

  B. subtilis MM (10 mL):

  • 10 mL SMM basic salts
  • 125 μL 40% (w/v) glucose
  • 100 μL 2% (w/v) tryptophan
  • 60 μL 1M Mg2SO4*7H2O
  • 10 μL 20% (w/v) casamino acids
  • 5 μL 2.2mg/ml ferric ammonium citrate.

  B. subtilis starvation media (10 mL):

  • 10 mL SMM basic salts
  • 125 μL 40% (w/v) glucose
  • 60 μL 1M Mg2SO4*7H2O

  M9 minimal medium recipe (1L):

  • 6 g Na2HPO4
  • 3 g KH2PO4
  • 0.5 g NH4Cl
  • 0.5 g NaCl
  • 0.2 g MgSO4·7H2O

  NA plates (100 mL):

  • 2.8 g oxoid nutrient agar
  • Up to 100 mL distilled water

  TSB (1 L):

  • 30 g Tryptic Soy Broth powder
  • Up to 1 L distilled water
  • 2xYT (1 L)
  • 16 g tryptone
  • 10 g yeast extract
  • 5 g NaCl
  • Up to 1 L distilled water.

  MS plates (1 L):

  • 20 g mannitol
  • 20 g soy flour
  • 20 g agar
  • Up to 1 L distilled water

  YPD (1 L):

  • 20 g peptone
  • 10 g yeast extract
  • Up to 1 L distilled water
  • Add glucose to 2% final concentration after autoclaving

  SC dropout plates (100 mL) (compounds from Formedium):

  • 690 mg Nitrogen base without amino acids
  • 162.2 mg of Leucine dropout or 192.6 mg of Uracil dropout mixture
  • 2.4 g agar
  • Up to 100 mL

  SC dropout plates without ammonium sulphate (100 mL) (compounds from Formedium):

  • 190 mg Nitrogen base without amino acids and without ammonium sulphate
  • 162.2 mg of Leucine dropout or 192.6 mg of Uracil dropout mixture
  • 2.4 g agar
  • Up to 100 mL

  GNA plates (100 mL):

  • 5 g D-glucose 3 g Nutrient broth 1 g yeast extract 2.4 g agar Up to 100 mL distilled water

  SPOR plates (100 mL):

  • 1 g potassium acetate
  • 100 mg yeast extract
  • 50 mg glucose
  • 2.4 g agar
  • Up to 100 mL distilled water